Product Details
- SNP ID
-
rs3093284
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.7:77195016 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TAGTATTTTAACTACTGTTCTATAT[A/C]TTTCAAAATTCATGTTTTCTATCTG
- Phenotype
-
MIM: 605351
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
CCDC146
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs570461530] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCDC146
- Gene Name
- coiled-coil domain containing 146
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_020879.2 |
2623 |
Intron |
|
|
NP_065930.2 |
- Gene
- FGL2
- Gene Name
- fibrinogen like 2
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_006682.2 |
2623 |
UTR 3 |
|
|
NP_006673.1 |
View Full Product Details