Product Details

SNP ID

rs17852944

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.7:102813475 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ATCATAGCCAAACCAACGTGGAGGG[C/T]CATTAGTGTTGTATTCCTGCTGCTG

Phenotype

MIM: 609080

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

FAM185A PubMed Links

Gene Details

Gene

FAM185A

Gene Name

family with sequence similarity 185 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145268.1	2306	Intron			NP_001138740.1
NM_001145269.1	2306	Intron			NP_001138741.1
XM_006715896.3	2306	Intron			XP_006715959.1
XM_011515922.2	2306	Intron			XP_011514224.1
XM_011515923.2	2306	Intron			XP_011514225.1
XM_011515924.2	2306	Intron			XP_011514226.1
XM_011515925.2	2306	Intron			XP_011514227.1
XM_011515926.2	2306	Intron			XP_011514228.1
XM_017011846.1	2306	Intron			XP_016867335.1
XM_017011847.1	2306	Intron			XP_016867336.1
XM_017011848.1	2306	Intron			XP_016867337.1
XM_017011849.1	2306	Intron			XP_016867338.1

Gene

FBXL13

Gene Name

F-box and leucine rich repeat protein 13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001111038.1	2306	Missense Mutation	GAC,GGC	D647G	NP_001104508.1
NM_001287150.1	2306	Missense Mutation	GAC,GGC	D664G	NP_001274079.1
NM_145032.3	2306	Missense Mutation	GAC,GGC	D692G	NP_659469.3
XM_005250205.3	2306	Missense Mutation	GAC,GGC	D782G	XP_005250262.1
XM_005250207.3	2306	Missense Mutation	GAC,GGC	D749G	XP_005250264.1
XM_005250208.3	2306	Missense Mutation	GAC,GGC	D737G	XP_005250265.1
XM_005250209.2	2306	Missense Mutation	GAC,GGC	D692G	XP_005250266.1
XM_006715898.2	2306	Missense Mutation	GAC,GGC	D541G	XP_006715961.1
XM_011515928.2	2306	Missense Mutation	GAC,GGC	D754G	XP_011514230.1
XM_011515929.2	2306	Intron			XP_011514231.1
XM_011515930.2	2306	Missense Mutation	GAC,GGC	D692G	XP_011514232.1
XM_011515932.2	2306	Intron			XP_011514234.1
XM_017011850.1	2306	Missense Mutation	GAC,GGC	D779G	XP_016867339.1
XM_017011851.1	2306	Intron			XP_016867340.1
XM_017011852.1	2306	Missense Mutation	GAC,GGC	D737G	XP_016867341.1
XM_017011853.1	2306	Missense Mutation	GAC,GGC	D692G	XP_016867342.1

View Full Product Details