Product Details

SNP ID: rs28936691
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2278016 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGGGGCTGCCCAGGCACTTGAAC[T/G]GCCCCTGCACCATGATGGCCAGCCG
Phenotype: MIM: 601615 MIM: 606447
Polymorphism: T/G, Transversion substitution
Allele Nomenclature
Literature Links: ABCA3 PubMed Links

Gene Details

Gene: ABCA3
Gene Name: ATP binding cassette subfamily A member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001089.2	5484	Missense Mutation	CAG,CCG	Q1591P	NP_001080.2

Gene: LOC106660606
Gene Name: uncharacterized LOC106660606

There are no transcripts associated with this gene.

Gene: MIR3677
Gene Name: microRNA 3677

There are no transcripts associated with this gene.

Gene: MIR4717
Gene Name: microRNA 4717

There are no transcripts associated with this gene.

Gene: MIR940
Gene Name: microRNA 940

There are no transcripts associated with this gene.

Gene: RNPS1
Gene Name: RNA binding protein with serine rich domain 1

There are no transcripts associated with this gene.

View Full Product Details