Product Details

SNP ID: rs17416993
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:120292217 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CAGTGGGAAAGCGAGCCTGGAGGGC[A/G]CAGACGGACGACTAGCTGTGCTCGA
Phenotype: MIM: 604482
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NME2P1 PubMed Links

Gene Details

Gene: NME2P1
Gene Name: NME/NM23 nucleoside diphosphate kinase 2 pseudogene 1

There are no transcripts associated with this gene.

Gene: RNU4-1
Gene Name: RNA, U4 small nuclear 1

There are no transcripts associated with this gene.

Gene: RNU4-2
Gene Name: RNA, U4 small nuclear 2

There are no transcripts associated with this gene.

Gene: SIRT4
Gene Name: sirtuin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012240.2	19	Intron			NP_036372.1
XM_005253865.4	19	Intron			XP_005253922.1
XM_006719308.2	19	UTR 5			XP_006719371.1
XM_006719309.3	19	Intron			XP_006719372.1

View Full Product Details