Product Details

SNP ID: rs11555862
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67661046 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCCCGCCCGGCCCCGCCATGGCCC[A/G]GCCGCAGAGGACTCCGGCGCGCAGT
Phenotype: MIM: 609377 MIM: 610859 MIM: 607484
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACD PubMed Links

Gene Details

Gene: ACD
Gene Name: adrenocortical dysplasia homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001082486.1	82	Intron			NP_001075955.1
NM_001082487.1	82	Intron			NP_001075956.1
NM_022914.2	82	Intron			NP_075065.2
XM_005256115.3	82	Intron			XP_005256172.1

Gene: C16orf86
Gene Name: chromosome 16 open reading frame 86

There are no transcripts associated with this gene.

Gene: CARMIL2
Gene Name: capping protein regulator and myosin 1 linker 2

There are no transcripts associated with this gene.

Gene: ENKD1
Gene Name: enkurin domain containing 1

There are no transcripts associated with this gene.

Gene: PARD6A
Gene Name: par-6 family cell polarity regulator alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001037281.1	82	Missense Mutation	CAG,CGG	Q3R	NP_001032358.1
NM_016948.2	82	Missense Mutation	CAG,CGG	Q3R	NP_058644.1
XM_005255977.3	82	Missense Mutation	CAG,CGG	Q3R	XP_005256034.1
XM_011523095.2	82	Missense Mutation	CAG,CGG	Q3R	XP_011521397.1
XM_011523096.2	82	Missense Mutation	CAG,CGG	Q3R	XP_011521398.1
XM_017023261.1	82	Missense Mutation	CAG,CGG	Q3R	XP_016878750.1

View Full Product Details