Product Details
- SNP ID
-
rs7399211
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.12:95081643 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- ATAGATGACAGCTGGGCCTGTGGTC[C/T]TCATTACCATAACAACATAGGTAAG
- Phenotype
-
MIM: 613520
MIM: 601529
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
FGD6
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs141185375] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- FGD6
- Gene Name
- FYVE, RhoGEF and PH domain containing 6
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_018351.3 |
|
Intron |
|
|
NP_060821.3 |
- Gene
- NR2C1
- Gene Name
- nuclear receptor subfamily 2 group C member 1
There are no transcripts associated with this gene.
View Full Product Details