Product Details

SNP ID: rs35913626
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:2242571 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTCGGGACAAAGTACACGGGCCTG[A/G]TGTGAAACTAAGCCACAAACCCATT
Phenotype: MIM: 602686 MIM: 606906 MIM: 600312 MIM: 614905
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MAD1L1 PubMed Links

Gene Details

Gene: MAD1L1
Gene Name: MAD1 mitotic arrest deficient like 1

There are no transcripts associated with this gene.

Gene: MRM2
Gene Name: mitochondrial rRNA methyltransferase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013393.1		Intron			NP_037525.1

Gene: NUDT1
Gene Name: nudix hydrolase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002452.3		Intron			NP_002443.3
NM_198948.1		Intron			NP_945186.1
NM_198949.1		Intron			NP_945187.1
NM_198950.1		Intron			NP_945188.1
NM_198952.1		Intron			NP_945190.1
NM_198953.1		Intron			NP_945191.1
NM_198954.1		Intron			NP_945192.1

Gene: SNX8
Gene Name: sorting nexin 8

There are no transcripts associated with this gene.

View Full Product Details