Product Details

SNP ID: rs17500918
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:27153859 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGAAGGGCATTGCGGAGGGCATTGG[A/G]CCTCCCCACCCACTACAGTTAACTC
Phenotype: MIM: 142954 MIM: 142951 MIM: 142950 MIM: 142956
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HOXA-AS3 PubMed Links

Gene Details

Gene: HOXA-AS3
Gene Name: HOXA cluster antisense RNA 3

There are no transcripts associated with this gene.

Gene: HOXA10-HOXA9
Gene Name: HOXA10-HOXA9 readthrough

There are no transcripts associated with this gene.

Gene: HOXA3
Gene Name: homeobox A3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030661.4	1875	Intron			NP_109377.1
NM_153631.2	1875	Intron			NP_705895.1

Gene: HOXA6
Gene Name: homeobox A6

There are no transcripts associated with this gene.

Gene: HOXA7
Gene Name: homeobox A7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006896.3	1875	UTR 3			NP_008827.2

Gene: HOXA9
Gene Name: homeobox A9

There are no transcripts associated with this gene.

View Full Product Details