Product Details
- SNP ID
-
rs28641550
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:51752990 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AAGACGAAATTTATGGTTTACTTTA[C/T]AAGAATTTTGCAAGAGGGTAATACT
- Phenotype
-
MIM: 136537
MIM: 136538
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
FPR1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs148888757] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- FPR1
- Gene Name
- formyl peptide receptor 1
There are no transcripts associated with this gene.
- Gene
- FPR2
- Gene Name
- formyl peptide receptor 2
View Full Product Details