Product Details

SNP ID: rs28427478
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:101392471 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTATTAAGGAATGACTTTAGTGCT[C/T]ATTTGGATGCAGTAAGTGGTTTGAT
Phenotype: MIM: 300300 MIM: 300644 MIM: 300902
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: BTK PubMed Links

Gene Details

Gene: BTK
Gene Name: Bruton tyrosine kinase

There are no transcripts associated with this gene.

Gene: GLA
Gene Name: galactosidase alpha

There are no transcripts associated with this gene.

Gene: RPL36A
Gene Name: ribosomal protein L36a

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199972.1		Intron			NP_001186901.1
NM_021029.5		Intron			NP_066357.2

Gene: RPL36A-HNRNPH2
Gene Name: RPL36A-HNRNPH2 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199973.1		Intron			NP_001186902.1
NM_001199974.1		Intron			NP_001186903.1

View Full Product Details