Product Details

SNP ID: rs28730681
Assay Type: Functionally tested
NCBI dbSNP Submissions: 9
Location: Chr.1:11109811 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTTAGCATCTAATTCTCTACGCAC[C/T]CTATTCCTTTAACGCCTGCCCTACC
Phenotype: MIM: 605960 MIM: 601231
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EXOSC10 PubMed Links

Gene Details

Gene: EXOSC10
Gene Name: exosome component 10

There are no transcripts associated with this gene.

Gene: LOC105376736
Gene Name: uncharacterized LOC105376736

There are no transcripts associated with this gene.

Gene: MTOR
Gene Name: mechanistic target of rapamycin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004958.3		Intron			NP_004949.1
XM_005263438.2		Intron			XP_005263495.1
XM_011541166.2		Intron			XP_011539468.1
XM_017000900.1		Intron			XP_016856389.1
XM_017000901.1		Intron			XP_016856390.1
XM_017000902.1		Intron			XP_016856391.1

View Full Product Details