Product Details

SNP ID: rs61746229
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:178441670 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTTGGCAAGAAATTTCTCAGCAGC[A/G]TTCCTTTTGGCTTGCTTTTTTGATG
Phenotype: MIM: 610219 MIM: 603424
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DFNB59 PubMed Links

Gene Details

Gene: DFNB59
Gene Name: deafness, autosomal recessive 59

There are no transcripts associated with this gene.

Gene: LOC101927027
Gene Name: uncharacterized LOC101927027

There are no transcripts associated with this gene.

Gene: PRKRA
Gene Name: protein activator of interferon induced protein kinase EIF2AK2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001139517.1	791	Silent Mutation	AAC,AAT	N172N	NP_001132989.1
NM_001139518.1	791	Silent Mutation	AAC,AAT	N158N	NP_001132990.1
NM_001316362.1	791	Silent Mutation	AAC,AAT	N70N	NP_001303291.1
NM_003690.4	791	Silent Mutation	AAC,AAT	N183N	NP_003681.1
XM_011512063.1	791	Silent Mutation	AAC,AAT	N98N	XP_011510365.1
XM_011512066.1	791	Silent Mutation	AAC,AAT	N70N	XP_011510368.1
XM_017005159.1	791	Silent Mutation	AAC,AAT	N70N	XP_016860648.1

View Full Product Details