Product Details

SNP ID: rs59277791
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:34637269 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGTGCCGAAGAGCAGCACATACTC[G/T]GACAGCGAGGCGTGCAGAAGGCACA
Phenotype: MIM: 606999 MIM: 601978
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ARID3C PubMed Links

Gene Details

Gene: ARID3C
Gene Name: AT-rich interaction domain 3C

There are no transcripts associated with this gene.

Gene: GALT
Gene Name: galactose-1-phosphate uridylyltransferase

There are no transcripts associated with this gene.

Gene: SIGMAR1
Gene Name: sigma non-opioid intracellular receptor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282205.1	432	Silent Mutation			NP_001269134.1
NM_001282206.1	432	Missense Mutation			NP_001269135.1
NM_001282207.1	432	Silent Mutation			NP_001269136.1
NM_001282208.1	432	Silent Mutation			NP_001269137.1
NM_001282209.1	432	Silent Mutation			NP_001269138.1
NM_005866.3	432	Silent Mutation			NP_005857.1
NM_147157.2	432	Silent Mutation			NP_671513.1

View Full Product Details