Product Details

SNP ID
rs58894130
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.9:123381197 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AAGGGTGCCGAGGAGAGGCAACCGC[C/G]GGGTGGGATGGGCACTCAGGAACTG
Phenotype
MIM: 609720 MIM: 613633
Polymorphism
C/G, Transversion Substitution
Allele Nomenclature
Literature Links
CRB2 PubMed Links
Additional Information
For this assay, SNP(s) [rs77969061] are located under a probe and SNP(s) [rs139826267] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CRB2
Gene Name
crumbs 2, cell polarity complex component
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_173689.6 4375 Intron NP_775960.4
XM_005251934.2 4375 Intron XP_005251991.1
XM_011518556.2 4375 Intron XP_011516858.1
XM_011518557.2 4375 Intron XP_011516859.1
XM_011518558.2 4375 Intron XP_011516860.1
Gene
DENND1A
Gene Name
DENN domain containing 1A
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_020946.1 4375 UTR 3 NP_065997.1
NM_024820.2 4375 Intron NP_079096.2
XM_005252109.2 4375 UTR 3 XP_005252166.1
XM_005252111.4 4375 UTR 3 XP_005252168.1
XM_005252113.4 4375 Intron XP_005252170.1
XM_006717195.3 4375 Intron XP_006717258.1
XM_011518882.2 4375 UTR 3 XP_011517184.1
XM_011518883.2 4375 UTR 3 XP_011517185.1
XM_011518884.2 4375 UTR 3 XP_011517186.1
XM_011518885.2 4375 UTR 3 XP_011517187.1
XM_011518886.2 4375 UTR 3 XP_011517188.1
XM_011518887.2 4375 Intron XP_011517189.1
XM_017014947.1 4375 UTR 3 XP_016870436.1
XM_017014948.1 4375 Intron XP_016870437.1
XM_017014949.1 4375 UTR 3 XP_016870438.1
XM_017014950.1 4375 UTR 3 XP_016870439.1
XM_017014951.1 4375 Intron XP_016870440.1
XM_017014952.1 4375 UTR 3 XP_016870441.1

View Full Product Details