Product Details

SNP ID
rs62094319
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.18:58044665 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCCGCGCGGGGCGCCGGCTCCATGG[A/C]GACCGGGCTCGGGGAGCCGGTCTAT
Phenotype
MIM: 606384
Polymorphism
A/C, Transversion Substitution
Allele Nomenclature
Literature Links
NEDD4L PubMed Links
Additional Information
For this assay, SNP(s) [rs113358301] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
NEDD4L
Gene Name
neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001144964.1 304 Intron NP_001138436.1
NM_001144965.1 304 Intron NP_001138437.1
NM_001144966.2 304 Intron NP_001138438.1
NM_001144967.2 304 Missense Mutation GAG,GCG E2A NP_001138439.1
NM_001144968.1 304 Intron NP_001138440.1
NM_001144969.1 304 Intron NP_001138441.1
NM_001144970.2 304 Intron NP_001138442.1
NM_001144971.1 304 Intron NP_001138443.1
NM_001243960.1 304 Missense Mutation GAG,GCG E2A NP_001230889.1
NM_015277.5 304 Missense Mutation GAG,GCG E2A NP_056092.2
XM_005266658.4 304 Intron XP_005266715.2
XM_005266660.4 304 Intron XP_005266717.2
XM_005266663.4 304 Intron XP_005266720.2
XM_006722421.3 304 Intron XP_006722484.2
XM_006722424.3 304 Intron XP_006722487.2
XM_006722425.3 304 Intron XP_006722488.2
XM_006722426.3 304 Missense Mutation GAG,GCG E2A XP_006722489.1
XM_006722428.3 304 Missense Mutation GAG,GCG E2A XP_006722491.1
XM_006722430.3 304 Intron XP_006722493.1
XM_011525887.2 304 Intron XP_011524189.1
XM_017025676.1 304 Intron XP_016881165.1
XM_017025677.1 304 Intron XP_016881166.1
XM_017025678.1 304 Missense Mutation GAG,GCG E2A XP_016881167.1
XM_017025679.1 304 Intron XP_016881168.1
XM_017025680.1 304 Intron XP_016881169.1
XM_017025681.1 304 Intron XP_016881170.1

View Full Product Details