Product Details
- SNP ID
-
rs111854688
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.3:122389389 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGGAAAGTAGTATAGATGGATAGAT[A/G]GATAGATAGATAGATAGATAGATAG
- Phenotype
-
MIM: 608017
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CCDC58
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs138873264] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCDC58
- Gene Name
- coiled-coil domain containing 58
There are no transcripts associated with this gene.
- Gene
- FAM162A
- Gene Name
- family with sequence similarity 162 member A
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_014367.3 |
|
Intron |
|
|
NP_055182.3 |
View Full Product Details