Product Details

SNP ID

rs74038928

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.13:20582077 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GTATTTTTGTGGGAAGTAGATTGAA[A/G]TAAATCAGAGGCAAGGATGAGAACT

Phenotype

MIM: 600595

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

IFT88 PubMed Links

Additional Information

For this assay, SNP(s) [rs148566134] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

IFT88

Gene Name

intraflagellar transport 88

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318491.1		Intron			NP_001305420.1
NM_001318493.1		Intron			NP_001305422.1
NM_006531.4		Intron			NP_006522.2
NM_175605.4		Intron			NP_783195.2
XM_005266553.2		Intron			XP_005266610.1
XM_006719870.3		Intron			XP_006719933.1
XM_011535241.2		Intron			XP_011533543.1
XM_011535242.1		Intron			XP_011533544.1
XM_011535243.1		Intron			XP_011533545.1
XM_017020757.1		Intron			XP_016876246.1
XM_017020758.1		Intron			XP_016876247.1
XM_017020759.1		Intron			XP_016876248.1
XM_017020760.1		Intron			XP_016876249.1
XM_017020761.1		Intron			XP_016876250.1
XM_017020762.1		Intron			XP_016876251.1
XM_017020763.1		Intron			XP_016876252.1
XM_017020764.1		Intron			XP_016876253.1
XM_017020765.1		Intron			XP_016876254.1
XM_017020766.1		Intron			XP_016876255.1
XM_017020767.1		Intron			XP_016876256.1
XM_017020768.1		Intron			XP_016876257.1
XM_017020769.1		Intron			XP_016876258.1
XM_017020770.1		Intron			XP_016876259.1
XM_017020771.1		Intron			XP_016876260.1
XM_017020772.1		Intron			XP_016876261.1
XM_017020773.1		Intron			XP_016876262.1
XM_017020774.1		Intron			XP_016876263.1
XM_017020775.1		Intron			XP_016876264.1
XM_017020776.1		Intron			XP_016876265.1

View Full Product Details