Product Details

SNP ID: rs74411786
Assay Type: Functionally tested
NCBI dbSNP Submissions: 19
Location: Chr.1:19603595 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTGACTTGGATAGCTTTAAAATTG[A/G]CTGTGTCCCTTTTCTCTTTGTTTTG
Phenotype: MIM: 616574
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC105378614 PubMed Links

Gene Details

Gene: LOC105378614
Gene Name: uncharacterized LOC105378614

There are no transcripts associated with this gene.

Gene: MINOS1
Gene Name: mitochondrial inner membrane organizing system 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001032363.3		Intron			NP_001027535.1
NM_001204082.1		Intron			NP_001191011.1
NM_001204083.1		Intron			NP_001191012.1

Gene: MINOS1-NBL1
Gene Name: MINOS1-NBL1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204088.1		Intron			NP_001191017.1
NM_001204089.1		Intron			NP_001191018.1

Gene: RPS14P3
Gene Name: ribosomal protein S14 pseudogene 3

There are no transcripts associated with this gene.

View Full Product Details