Product Details

SNP ID: rs76357989
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:177219406 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTTTTTTATCCTGTATTATTCAAC[A/G]GGCTACAGTTCTTAGCAGGAGAGAG
Phenotype: MIM: 605372
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HNRNPA3 PubMed Links

Gene Details

Gene: HNRNPA3
Gene Name: heterogeneous nuclear ribonucleoprotein A3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_005246380.1		Intron			XP_005246437.1
XM_005246381.4		Intron			XP_005246438.1
XM_006712365.2		Intron			XP_006712428.1
XM_017003587.1		Intron			XP_016859076.1
XM_017003588.1		Intron			XP_016859077.1

Gene: LOC105373759
Gene Name: uncharacterized LOC105373759

There are no transcripts associated with this gene.

Gene: MIR4444-1
Gene Name: microRNA 4444-1

There are no transcripts associated with this gene.

View Full Product Details