Product Details

SNP ID: rs634696
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:126270459 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGAGTATGTAACAATACAAACTGCA[A/G]TTGTGTCCAAGAGATCATGTAGAGT
Phenotype: MIM: 616587 MIM: 613622 MIM: 182180
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAM118B PubMed Links

Gene Details

Gene: FAM118B
Gene Name: family with sequence similarity 118 member B

There are no transcripts associated with this gene.

Gene: FOXRED1
Gene Name: FAD dependent oxidoreductase domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017547.3	407	Intron			NP_060017.1
XM_006718879.3	407	Intron			XP_006718942.1
XM_006718881.3	407	Intron			XP_006718944.1
XM_011542895.2	407	Intron			XP_011541197.1
XM_011542896.2	407	Intron			XP_011541198.1
XM_017018000.1	407	Intron			XP_016873489.1
XM_017018001.1	407	Intron			XP_016873490.1
XM_017018002.1	407	Intron			XP_016873491.1
XM_017018003.1	407	Intron			XP_016873492.1
XM_017018004.1	407	Intron			XP_016873493.1
XM_017018005.1	407	UTR 5			XP_016873494.1
XM_017018006.1	407	Intron			XP_016873495.1

Gene: SRPRA
Gene Name: SRP receptor alpha subunit

There are no transcripts associated with this gene.

View Full Product Details