Product Details

SNP ID: rs4778691
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:82839526 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACTTAAAAACAGACACAAATATTTT[T/A]CTGAACTATGTATTTCTACAGAAAC
Phenotype: MIM: 604799 MIM: 612393
Polymorphism: T/A, Transversion substitution
Allele Nomenclature
Literature Links: HOMER2 PubMed Links

Gene Details

Gene: HOMER2
Gene Name: homer scaffolding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004839.3		Intron			NP_004830.2
NM_199330.2		Intron			NP_955362.1
XM_005272448.4		Intron			XP_005272505.1
XM_005272449.3		Intron			XP_005272506.1
XM_006720775.3		Intron			XP_006720838.1
XM_006720776.3		Intron			XP_006720839.1
XM_011522231.2		Intron			XP_011520533.1
XM_011522232.2		Intron			XP_011520534.1
XM_011522233.2		Intron			XP_011520535.1
XM_011522234.2		Intron			XP_011520536.1

Gene: WHAMM
Gene Name: WAS protein homolog associated with actin, golgi membranes and microtubules

There are no transcripts associated with this gene.

View Full Product Details