Product Details
- SNP ID
-
rs2631361
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.5:132371688 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGCTTCCCAGAAGAGGAGGCCTCTC[A/C]GTGAGCCTAGGGTGTTCAGCTCAGC
- Phenotype
-
MIM: 603377
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC553103
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs75817769] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC553103
- Gene Name
- uncharacterized LOC553103
There are no transcripts associated with this gene.
- Gene
- MIR3936
- Gene Name
- microRNA 3936
There are no transcripts associated with this gene.
- Gene
- SLC22A5
- Gene Name
- solute carrier family 22 member 5
View Full Product Details