Product Details

SNP ID: rs3779109
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:6016853 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACGAGTGAAAGCGTAGAATAAGAAA[C/G]TCTTTATCTAAAAAGGCTGTCATGC
Phenotype: MIM: 600859 MIM: 613635 MIM: 600259
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: AIMP2 PubMed Links

Gene Details

Gene: AIMP2
Gene Name: aminoacyl tRNA synthetase complex interacting multifunctional protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001326606.1		Intron			NP_001313535.1
NM_001326607.1		Intron			NP_001313536.1
NM_001326609.1		Intron			NP_001313538.1
NM_001326611.1		Intron			NP_001313540.1
NM_006303.3		Intron			NP_006294.2
XM_005249847.3		Intron			XP_005249904.1
XM_005249848.2		Intron			XP_005249905.1
XM_005249850.3		Intron			XP_005249907.1
XM_006715772.2		Intron			XP_006715835.1
XM_011515519.1		Intron			XP_011513821.1

Gene: EIF2AK1
Gene Name: eukaryotic translation initiation factor 2 alpha kinase 1

There are no transcripts associated with this gene.

Gene: PMS2
Gene Name: PMS1 homolog 2, mismatch repair system component

There are no transcripts associated with this gene.

View Full Product Details