Product Details

SNP ID
rs11781048
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.8:617450 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TCCATTTGGTCCTCATCTGACCCCA[C/G]TGGGGAGTGCTGAGTGCTTGGTGCT
Phenotype
Polymorphism
C/G, Transversion Substitution
Allele Nomenclature
Literature Links
ERICH1 PubMed Links
Additional Information
For this assay, SNP(s) [rs114231375] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ERICH1
Gene Name
glutamate rich 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001303100.1 Intron NP_001290029.1
NM_207332.2 Intron NP_997215.1
XM_006716234.3 Intron XP_006716297.2
XM_011534731.2 Intron XP_011533033.1
XM_011534735.2 Intron XP_011533037.1
XM_011534736.2 Intron XP_011533038.1
XM_011534737.2 Intron XP_011533039.1
XM_011534739.2 Intron XP_011533041.1
XM_017013114.1 Intron XP_016868603.1
XM_017013115.1 Intron XP_016868604.1
XM_017013116.1 Intron XP_016868605.1
XM_017013117.1 Intron XP_016868606.1
XM_017013118.1 Intron XP_016868607.1
XM_017013119.1 Intron XP_016868608.1
XM_017013120.1 Intron XP_016868609.1
XM_017013121.1 Intron XP_016868610.1
XM_017013122.1 Intron XP_016868611.1
XM_017013123.1 Intron XP_016868612.1
XM_017013124.1 Intron XP_016868613.1
XM_017013125.1 Intron XP_016868614.1
XM_017013126.1 Intron XP_016868615.1
XM_017013127.1 Intron XP_016868616.1
XM_017013128.1 Intron XP_016868617.1
XM_017013129.1 Intron XP_016868618.1
XM_017013130.1 Intron XP_016868619.1
XM_017013131.1 Intron XP_016868620.1
XM_017013132.1 Intron XP_016868621.1
XM_017013133.1 Intron XP_016868622.1
XM_017013134.1 Intron XP_016868623.1
XM_017013135.1 Intron XP_016868624.1
XM_017013136.1 Intron XP_016868625.1
XM_017013137.1 Intron XP_016868626.1
XM_017013138.1 Intron XP_016868627.1
XM_017013139.1 Intron XP_016868628.1

View Full Product Details