Product Details

SNP ID: rs2542588
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.2:53791787 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GAAAGGAATTACAAATGTTATGTCT[C/T]ATAGCAAATCGTTGGCACAATTGAA
Phenotype: MIM: 605760 MIM: 611229
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ASB3 PubMed Links

Gene Details

Gene: ASB3
Gene Name: ankyrin repeat and SOCS box containing 3

There are no transcripts associated with this gene.

Gene: ERLEC1
Gene Name: endoplasmic reticulum lectin 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127397.2		Intron			NP_001120869.1
NM_001127398.2		Intron			NP_001120870.1
NM_015701.4		Intron			NP_056516.2
XM_011532766.1		Intron			XP_011531068.1

Gene: GPR75-ASB3
Gene Name: GPR75-ASB3 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164165.1		Intron			NP_001157637.1

View Full Product Details