Product Details

SNP ID: rs9933843
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30892358 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACATGAGAGTGAGGAGAAAGATAAA[T/C]TAGTAAAAAATTAATTTACATGAAA
Phenotype: MIM: 605847 MIM: 600435
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: BCL7C PubMed Links

Gene Details

Gene: BCL7C
Gene Name: BCL tumor suppressor 7C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286526.1		Intron			NP_001273455.1
NM_004765.3		Intron			NP_004756.2
XM_011545980.2		Intron			XP_011544282.1
XM_017023885.1		Intron			XP_016879374.1
XM_017023886.1		Intron			XP_016879375.1
XM_017023887.1		Intron			XP_016879376.1
XM_017023888.1		Intron			XP_016879377.1

Gene: CTF1
Gene Name: cardiotrophin 1

There are no transcripts associated with this gene.

Gene: MIR762
Gene Name: microRNA 762

There are no transcripts associated with this gene.

Gene: MIR762HG
Gene Name: MIR762 host gene

There are no transcripts associated with this gene.

View Full Product Details