Product Details

SNP ID: rs376292
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:61788228 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGGCGTTTGTTCCTGTAGTCACTG[C/G]GCTAATCTCCCCCTAGCTTCAAGCT
Phenotype: MIM: 600393 MIM: 608329
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FEN1 PubMed Links

Gene Details

Gene: FEN1
Gene Name: flap structure-specific endonuclease 1

There are no transcripts associated with this gene.

Gene: MIR611
Gene Name: microRNA 611

There are no transcripts associated with this gene.

Gene: MYRF
Gene Name: myelin regulatory factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127392.2	5526	UTR 3			NP_001120864.1
NM_013279.3	5526	UTR 3			NP_037411.1
XM_005274222.1	5526	UTR 3			XP_005274279.1
XM_005274223.1	5526	UTR 3			XP_005274280.1
XM_005274224.1	5526	UTR 3			XP_005274281.1
XM_005274225.1	5526	UTR 3			XP_005274282.1
XM_005274226.1	5526	UTR 3			XP_005274283.1
XM_005274227.1	5526	UTR 3			XP_005274284.1
XM_005274228.1	5526	UTR 3			XP_005274285.1
XM_011545234.2	5526	UTR 3			XP_011543536.1

Gene: TMEM258
Gene Name: transmembrane protein 258

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014206.3	5526	Intron			NP_055021.1

View Full Product Details