Product Details

SNP ID: rs745632
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.12:12474929 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: TAAAAACTAACTCAAATCGTTGACC[A/G]GCACTTTCCCAGTATCATAACAATG
Phenotype: MIM: 616598 MIM: 607175
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BORCS5 PubMed Links

Gene Details

Gene: BORCS5
Gene Name: BLOC-1 related complex subunit 5

There are no transcripts associated with this gene.

Gene: DUSP16
Gene Name: dual specificity phosphatase 16

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030640.2	4393	UTR 3			NP_085143.1
XM_005253488.2	4393	UTR 3			XP_005253545.1
XM_006719155.2	4393	UTR 3			XP_006719218.1
XM_011520856.1	4393	UTR 3			XP_011519158.1
XM_011520857.1	4393	UTR 3			XP_011519159.1
XM_017019988.1	4393	UTR 3			XP_016875477.1

Gene: LOC105369662
Gene Name: uncharacterized LOC105369662

There are no transcripts associated with this gene.

View Full Product Details