Product Details
- SNP ID
-
rs756571
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:112170396 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTGAAGATCTTATTGACTGTACCTG[C/T]TTTCTTTATTTTGTCCTGTTAGTCT
- Phenotype
-
MIM: 611740
MIM: 600953
MIM: 605791
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
BCO2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs149903853] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- BCO2
- Gene Name
- beta-carotene oxygenase 2
There are no transcripts associated with this gene.
- Gene
- IL18
- Gene Name
- interleukin 18
There are no transcripts associated with this gene.
- Gene
- TEX12
- Gene Name
- testis expressed 12
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_031275.4 |
|
Intron |
|
|
NP_112565.1 |
View Full Product Details