Product Details

SNP ID: rs11206309
Assay Type: Validated
NCBI dbSNP Submissions: 33
Location: Chr.1:54228581 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: GGCCTCTAAGCCCTTCCATCCCAGT[C/G]CCACACTGTGCGGAGGGCTTTCTGT
Phenotype: MIM: 611843 MIM: 607390
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: MRPL37 PubMed Links

Gene Details

Gene: MRPL37
Gene Name: mitochondrial ribosomal protein L37

There are no transcripts associated with this gene.

Gene: SSBP3
Gene Name: single stranded DNA binding protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001009955.3		Intron			NP_001009955.1
NM_018070.4		Intron			NP_060540.2
NM_145716.3		Intron			NP_663768.1
XM_006710545.3		Intron			XP_006710608.1
XM_017000897.1		Intron			XP_016856386.1
XM_017000898.1		Intron			XP_016856387.1
XM_017000899.1		Intron			XP_016856388.1

Gene: SSBP3-AS1
Gene Name: SSBP3 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details