Product Details

SNP ID: rs3130931
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31167111 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CATCCAGCATGACAGAAGTGCTATT[C/T]GGCACTTGTTCTTCAAGTTGCCCAC
Phenotype: MIM: 605310 MIM: 164177 MIM: 600912
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCHCR1 PubMed Links

Gene Details

Gene: CCHCR1
Gene Name: coiled-coil alpha-helical rod protein 1

There are no transcripts associated with this gene.

Gene: POU5F1
Gene Name: POU class 5 homeobox 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001173531.2	60	UTR 5			NP_001167002.1
NM_001285986.1	60	UTR 5			NP_001272915.1
NM_001285987.1	60	UTR 5			NP_001272916.1
NM_002701.5	60	Intron			NP_002692.2
NM_203289.5	60	UTR 5			NP_976034.4

Gene: PSORS1C3
Gene Name: psoriasis susceptibility 1 candidate 3 (non-protein coding)

There are no transcripts associated with this gene.

Gene: TCF19
Gene Name: transcription factor 19

There are no transcripts associated with this gene.

View Full Product Details