Product Details

SNP ID: rs740404
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.19:2232050 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: AGACACTCCCAGACTGAGGGGTGGT[A/G]TGTGGCGGGTGGCAGGGTGGCTGTG
Phenotype: MIM: 607375 MIM: 600796
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DOT1L PubMed Links

Gene Details

Gene: DOT1L
Gene Name: DOT1 like histone lysine methyltransferase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032482.2	8995	UTR 3			NP_115871.1
XM_005259659.3	8995	UTR 3			XP_005259716.1
XM_005259660.3	8995	UTR 3			XP_005259717.1
XM_011528359.2	8995	UTR 3			XP_011526661.1
XM_011528360.1	8995	UTR 3			XP_011526662.1
XM_011528361.2	8995	UTR 3			XP_011526663.1
XM_017027366.1	8995	UTR 3			XP_016882855.1

Gene: MIR1227
Gene Name: microRNA 1227

There are no transcripts associated with this gene.

Gene: MIR6789
Gene Name: microRNA 6789

There are no transcripts associated with this gene.

Gene: PLEKHJ1
Gene Name: pleckstrin homology domain containing J1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300836.1	8995	Intron			NP_001287765.1
NM_018049.2	8995	Intron			NP_060519.1
XM_017026924.1	8995	Intron			XP_016882413.1
XM_017026925.1	8995	Intron			XP_016882414.1
XM_017026926.1	8995	Intron			XP_016882415.1
XM_017026927.1	8995	Intron			XP_016882416.1
XM_017026928.1	8995	Intron			XP_016882417.1

Gene: SF3A2
Gene Name: splicing factor 3a subunit 2

There are no transcripts associated with this gene.

View Full Product Details