Product Details

SNP ID: rs4688682
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:50229696 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTGCTGCCTCTGTCGTCACTCTCTT[A/C]TGGCTTGTTACAAGACTGGTCCTTC
Phenotype: MIM: 139360 MIM: 604437
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: GNAI2 PubMed Links

Gene Details

Gene: GNAI2
Gene Name: G protein subunit alpha i2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001166425.1		Intron			NP_001159897.1
NM_001282617.1		Intron			NP_001269546.1
NM_001282618.1		Intron			NP_001269547.1
NM_001282619.1		Intron			NP_001269548.1
NM_001282620.1		Intron			NP_001269549.1
NM_002070.3		Intron			NP_002061.1

Gene: MIR5787
Gene Name: microRNA 5787

There are no transcripts associated with this gene.

Gene: SLC38A3
Gene Name: solute carrier family 38 member 3

There are no transcripts associated with this gene.

View Full Product Details