Product Details

SNP ID: rs2072291
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.14:73959969 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GGTCTAGATTATGTGGAGGAGTGTA[C/T]ACACGGAAATGCAAAACAATAGAAA
Phenotype: MIM: 614647 MIM: 603162
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: COQ6 PubMed Links

Gene Details

Gene: COQ6
Gene Name: coenzyme Q6, monooxygenase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182476.2		Intron			NP_872282.1
NM_182480.2		Intron			NP_872286.2
XM_006720156.1		Intron			XP_006720219.1
XM_011536807.1		Intron			XP_011535109.1
XM_011536808.1		Intron			XP_011535110.1
XM_011536809.2		Intron			XP_011535111.1
XM_011536810.2		Intron			XP_011535112.1
XM_017021351.1		Intron			XP_016876840.1
XM_017021352.1		Intron			XP_016876841.1

Gene: ENTPD5
Gene Name: ectonucleoside triphosphate diphosphohydrolase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001249.3		Intron			NP_001240.1
NM_001321984.1		Intron			NP_001308913.1
NM_001321985.1		Intron			NP_001308914.1
NM_001321986.1		Intron			NP_001308915.1
NM_001321987.1		Intron			NP_001308916.1
NM_001321988.1		Intron			NP_001308917.1
XM_005268224.3		Intron			XP_005268281.1
XM_006720325.3		Intron			XP_006720388.1
XM_006720326.2		Intron			XP_006720389.1
XM_017021813.1		Intron			XP_016877302.1
XM_017021814.1		Intron			XP_016877303.1
XM_017021815.1		Intron			XP_016877304.1
XM_017021816.1		Intron			XP_016877305.1
XM_017021817.1		Intron			XP_016877306.1

Gene: FAM161B
Gene Name: family with sequence similarity 161 member B

There are no transcripts associated with this gene.

View Full Product Details