Product Details

SNP ID: rs2195199
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:14775060 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAGCTGTGTAGTCGCGGGGACATG[C/T]CGGATGGCCCCAGGGGAGGGGGGCG
Phenotype: MIM: 615069
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C12orf60 PubMed Links

Gene Details

Gene: C12orf60
Gene Name: chromosome 12 open reading frame 60

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_175874.3	725	Intron			NP_787070.2
XM_005253322.4	725	Intron			XP_005253379.1
XM_011520568.2	725	Intron			XP_011518870.1
XM_011520569.2	725	Intron			XP_011518871.1
XM_017018871.1	725	Intron			XP_016874360.1
XM_017018872.1	725	Intron			XP_016874361.1
XM_017018873.1	725	Intron			XP_016874362.1
XM_017018874.1	725	Intron			XP_016874363.1

Gene: H2AFJ
Gene Name: H2A histone family member J

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_177925.3	725	UTR 3			NP_808760.1

Gene: HIST4H4
Gene Name: histone cluster 4, H4

There are no transcripts associated with this gene.

Gene: LOC105369669
Gene Name: uncharacterized LOC105369669

There are no transcripts associated with this gene.

View Full Product Details