Product Details

SNP ID: rs6753709
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:178454664 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTGCTAGATATGTTTGAAATACATT[A/G]GTAGTATATCCAAACTTTGAATAAG
Phenotype: MIM: 610219 MIM: 607062 MIM: 603424
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DFNB59 PubMed Links

Gene Details

Gene: DFNB59
Gene Name: deafness, autosomal recessive 59

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042702.3		Intron			NP_001036167.1
XM_005246627.2		Intron			XP_005246684.1
XM_005246628.3		Intron			XP_005246685.1
XM_005246629.3		Intron			XP_005246686.1
XM_011511247.2		Intron			XP_011509549.1
XM_011511249.2		Intron			XP_011509551.1
XM_011511250.2		Intron			XP_011509552.1
XM_011511251.1		Intron			XP_011509553.1
XM_017004221.1		Intron			XP_016859710.1
XM_017004222.1		Intron			XP_016859711.1
XM_017004223.1		Intron			XP_016859712.1
XM_017004224.1		Intron			XP_016859713.1
XM_017004225.1		Intron			XP_016859714.1

Gene: FKBP7
Gene Name: FK506 binding protein 7

There are no transcripts associated with this gene.

Gene: PRKRA
Gene Name: protein activator of interferon induced protein kinase EIF2AK2

There are no transcripts associated with this gene.

View Full Product Details