Product Details

SNP ID: rs2247619
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45407809 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTTGGTTATGCCATTTTCAGATGGG[A/G]AGACTAAGACCAGAAAGGTGATTTC
Phenotype: MIM: 611453 MIM: 610272
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DBNDD2 PubMed Links

Gene Details

Gene: DBNDD2
Gene Name: dysbindin domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001048221.2		Intron			NP_001041686.1
NM_001048222.2		Intron			NP_001041687.1
NM_001048223.2		Intron			NP_001041688.1
NM_001048224.2		Intron			NP_001041689.1
NM_001048225.2		Intron			NP_001041690.2
NM_001048226.2		Intron			NP_001041691.2
NM_001197139.1		Intron			NP_001184068.1
NM_001197140.1		Intron			NP_001184069.1
NM_018478.3		Intron			NP_060948.3

Gene: PIGT
Gene Name: phosphatidylinositol glycan anchor biosynthesis class T

There are no transcripts associated with this gene.

Gene: SYS1-DBNDD2
Gene Name: SYS1-DBNDD2 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details