Product Details

SNP ID: rs34203441
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:12669428 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAGCGAGTCGAAGGCCAGATCACGC[C/T]TCTTCCGCTGCAGGAATCGCAGCTT
Phenotype: MIM: 600944 MIM: 609458 MIM: 616850
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DHPS PubMed Links

Gene Details

Gene: DHPS
Gene Name: deoxyhypusine synthase

There are no transcripts associated with this gene.

Gene: MAN2B1
Gene Name: mannosidase alpha class 2B member 1

There are no transcripts associated with this gene.

Gene: WDR83
Gene Name: WD repeat domain 83

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099737.2	224	Intron			NP_001093207.1
NM_032332.3	224	Intron			NP_115708.1

Gene: WDR83OS
Gene Name: WD repeat domain 83 opposite strand

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016145.3	224	UTR 5			NP_057229.1
XM_017026864.1	224	UTR 5			XP_016882353.1

View Full Product Details