Product Details

SNP ID: rs2952151
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:39672243 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCTCCTGGGAACCTGGCTAGGGCAA[C/T]GGTCAGGGTGAAACTCCTTCCCAAT
Phenotype: MIM: 611801 MIM: 171190 MIM: 607048 MIM: 604488
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PGAP3 PubMed Links

Gene Details

Gene: PGAP3
Gene Name: post-GPI attachment to proteins 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001291726.1	1112	UTR 3			NP_001278655.1
NM_001291728.1	1112	UTR 3			NP_001278657.1
NM_001291730.1	1112	UTR 3			NP_001278659.1
NM_001291732.1	1112	UTR 3			NP_001278661.1
NM_001291733.1	1112	UTR 3			NP_001278662.1
NM_033419.4	1112	UTR 3			NP_219487.3
XM_011525480.2	1112	UTR 3			XP_011523782.1
XM_011525481.2	1112	UTR 3			XP_011523783.1

Gene: PNMT
Gene Name: phenylethanolamine N-methyltransferase

There are no transcripts associated with this gene.

Gene: STARD3
Gene Name: StAR related lipid transfer domain containing 3

There are no transcripts associated with this gene.

Gene: TCAP
Gene Name: titin-cap

There are no transcripts associated with this gene.

View Full Product Details