Product Details

SNP ID: rs11216313
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:117200646 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCAGGAGGAGGAAGGGGAAGGATG[A/G]TGGTGCTGGGTGGGAGTGGGGATGG
Phenotype: MIM: 604872 MIM: 600818
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC100652768 PubMed Links

Gene Details

Gene: LOC100652768
Gene Name: uncharacterized LOC100652768

There are no transcripts associated with this gene.

Gene: PCSK7
Gene Name: proprotein convertase subtilisin/kexin type 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004716.3		Intron			NP_004707.2

Gene: SIDT2
Gene Name: SID1 transmembrane family member 2

There are no transcripts associated with this gene.

Gene: TAGLN
Gene Name: transgelin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001522.1		Intron			NP_001001522.1
NM_003186.3		Intron			NP_003177.2

View Full Product Details