Product Details

SNP ID: rs8092228
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.18:3250624 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAAGTAAAGGCCTAGGTAGTAACTT[C/G]CTCAACATTACACTGCCAGTTTTTG
Phenotype
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LOC101927044 PubMed Links

Gene Details

Gene: LOC101927044
Gene Name: uncharacterized LOC101927044

There are no transcripts associated with this gene.

Gene: LOC104968399
Gene Name: uncharacterized LOC104968399

There are no transcripts associated with this gene.

Gene: MYL12A
Gene Name: myosin light chain 12A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303047.1		Intron			NP_001289976.1
NM_001303048.1		Intron			NP_001289977.1
NM_001303049.1		Intron			NP_001289978.1
NM_006471.3		Intron			NP_006462.1

View Full Product Details