Product Details
- SNP ID
-
rs873882
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.8:144531065 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTTTCGGCTCCTGGGGGCCTGAACT[C/T]GATCCTGGAGGCATGTGGGTCACGC
- Phenotype
-
MIM: 615880
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ARHGAP39
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs529573768] are located under a probe and SNP(s) [rs113457747] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ARHGAP39
- Gene Name
- Rho GTPase activating protein 39
- Gene
- C8orf82
- Gene Name
- chromosome 8 open reading frame 82
There are no transcripts associated with this gene.
- Gene
- LRRC14
- Gene Name
- leucine rich repeat containing 14
There are no transcripts associated with this gene.
- Gene
- LRRC24
- Gene Name
- leucine rich repeat containing 24
There are no transcripts associated with this gene.
View Full Product Details