Product Details

SNP ID

rs1021728

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.12:99647850 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GGCTGTTGTGAAGTGGAATATCAGG[C/T]TCAAATGGAGGTCCCTCCCGAATGA

Phenotype

MIM: 607815

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

ANKS1B PubMed Links

Gene Details

Gene

ANKS1B

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204065.1	101	Intron			NP_001190994.1
NM_001204066.1	101	Intron			NP_001190995.1
NM_001204067.1	101	Intron			NP_001190996.1
NM_001204068.1	101	Intron			NP_001190997.1
NM_001204069.1	101	Intron			NP_001190998.1
NM_001204070.1	101	Intron			NP_001190999.1
NM_001204079.1	101	Intron			NP_001191008.1
NM_001204080.1	101	Intron			NP_001191009.1
NM_001204081.1	101	Intron			NP_001191010.1
NM_020140.3	101	Intron			NP_064525.1
NM_152788.4	101	Intron			NP_690001.3
NM_181670.3	101	Intron			NP_858056.2
XM_005269028.4	101	Intron			XP_005269085.1
XM_005269029.4	101	Intron			XP_005269086.1
XM_005269032.3	101	Intron			XP_005269089.1
XM_006719504.3	101	Intron			XP_006719567.1
XM_006719505.3	101	Intron			XP_006719568.1
XM_006719506.3	101	Intron			XP_006719569.1
XM_006719507.3	101	Intron			XP_006719570.1
XM_006719508.3	101	Intron			XP_006719571.1
XM_006719509.3	101	Intron			XP_006719572.1
XM_006719510.3	101	Intron			XP_006719573.1
XM_006719512.3	101	Intron			XP_006719575.1
XM_006719513.3	101	Intron			XP_006719576.1
XM_006719514.3	101	Intron			XP_006719577.1
XM_011538571.2	101	Intron			XP_011536873.1
XM_017019651.1	101	Intron			XP_016875140.1
XM_017019652.1	101	Intron			XP_016875141.1
XM_017019653.1	101	Intron			XP_016875142.1
XM_017019654.1	101	Intron			XP_016875143.1
XM_017019655.1	101	Intron			XP_016875144.1
XM_017019656.1	101	Intron			XP_016875145.1
XM_017019657.1	101	Intron			XP_016875146.1
XM_017019658.1	101	Intron			XP_016875147.1
XM_017019659.1	101	Intron			XP_016875148.1
XM_017019660.1	101	Intron			XP_016875149.1
XM_017019661.1	101	Intron			XP_016875150.1
XM_017019662.1	101	Intron			XP_016875151.1
XM_017019663.1	101	Intron			XP_016875152.1
XM_017019664.1	101	Intron			XP_016875153.1
XM_017019665.1	101	Intron			XP_016875154.1

Gene

FAM71C

Gene Name

family with sequence similarity 71 member C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153364.3	101	UTR 5			NP_699195.1

View Full Product Details