Product Details

SNP ID: rs1541776
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:169819717 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGATTAAGTTAGTAGGATTTAGAAA[C/T]ATTTTCTTCCAAACTTCAAAATAGC
Phenotype: MIM: 109090 MIM: 613831
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: METTL5 PubMed Links

Gene Details

Gene: METTL5
Gene Name: methyltransferase like 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001293186.1		Intron			NP_001280115.1
NM_001293187.1		Intron			NP_001280116.1
NM_014168.3		Intron			NP_054887.2
XM_011511023.1		Intron			XP_011509325.1

Gene: SSB
Gene Name: Sjogren syndrome antigen B

There are no transcripts associated with this gene.

Gene: UBR3
Gene Name: ubiquitin protein ligase E3 component n-recognin 3 (putative)

There are no transcripts associated with this gene.

View Full Product Details