Product Details

SNP ID: rs2668209
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.3:165776779 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TATATTTTATAAAGAAAAATGAATC[G/A]ATTGACCTTTCCAGATTCTTATGTA
Phenotype: MIM: 177400
Polymorphism: G/A, Transition Substitution
Allele Nomenclature
Literature Links: BCHE PubMed Links
Additional Information: For this assay, SNP(s) [rs73877726] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017006967.1		Intron			XP_016862456.1