Product Details

SNP ID: rs1061807
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:32169061 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTAGGAGGTGGGGGTCAAGAGTGGA[A/G]ACTGCACCGAGGCAAGAGTCCATGG
Phenotype: MIM: 603099 MIM: 609897 MIM: 603298 MIM: 602677
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AGPAT1 PubMed Links

Gene Details

Gene: AGPAT1
Gene Name: 1-acylglycerol-3-phosphate O-acyltransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006411.3	1705	UTR 3			NP_006402.1
NM_032741.4	1705	UTR 3			NP_116130.2
XM_005248805.3	1705	UTR 3			XP_005248862.1
XM_005248806.2	1705	UTR 3			XP_005248863.1
XM_011514234.1	1705	UTR 3			XP_011512536.1

Gene: EGFL8
Gene Name: EGF like domain multiple 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030652.3	1705	Intron			NP_085155.1

Gene: MIR6721
Gene Name: microRNA 6721

There are no transcripts associated with this gene.

Gene: PPT2
Gene Name: palmitoyl-protein thioesterase 2

There are no transcripts associated with this gene.

Gene: PPT2-EGFL8
Gene Name: PPT2-EGFL8 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: RNF5
Gene Name: ring finger protein 5

There are no transcripts associated with this gene.

View Full Product Details