Product Details

SNP ID: rs7546
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:4797316 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCCTGGCACTTCCAGTGTCCATTCC[C/T]GGCAGTGCAAATGTGTTAGGTGGGG
Phenotype: MIM: 610660 MIM: 614574 MIM: 611562
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GLYR1 PubMed Links

Gene Details

Gene: GLYR1
Gene Name: glyoxylate reductase 1 homolog

There are no transcripts associated with this gene.

Gene: ROGDI
Gene Name: rogdi homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024589.2	1387	UTR 3			NP_078865.1
XM_006720947.3	1387	UTR 3			XP_006721010.1
XM_006720948.3	1387	UTR 3			XP_006721011.1

Gene: SEPT12
Gene Name: septin 12

There are no transcripts associated with this gene.

Gene: SMIM22
Gene Name: small integral membrane protein 22

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001253790.1	1387	Intron			NP_001240719.1
NM_001253791.1	1387	Intron			NP_001240720.1
NM_001253793.1	1387	Intron			NP_001240722.1
NM_001253794.1	1387	Intron			NP_001240723.1
XM_011522499.2	1387	Intron			XP_011520801.1
XM_011522500.2	1387	Intron			XP_011520802.1
XM_011522501.2	1387	Intron			XP_011520803.1

View Full Product Details