Product Details

SNP ID: rs2236582
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.6:109444615 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CTCCTCTGGCTTCCTCCTGAATTGT[C/G]TCAGAGGTACACAGACTAGAGCATC
Phenotype: MIM: 607129 MIM: 603498
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: MICAL1 PubMed Links

Gene Details

Gene: MICAL1
Gene Name: microtubule associated monooxygenase, calponin and LIM domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001159291.1		Intron			NP_001152763.1
NM_001286613.1		Intron			NP_001273542.1
NM_022765.3		Intron			NP_073602.3

Gene: PPIL6
Gene Name: peptidylprolyl isomerase like 6

There are no transcripts associated with this gene.

Gene: SMPD2
Gene Name: sphingomyelin phosphodiesterase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003080.2		Intron			NP_003071.2
XM_005267109.1		Intron			XP_005267166.1
XM_011536079.1		Intron			XP_011534381.1

View Full Product Details