Product Details

SNP ID: rs13409
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31164363 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAGTGTGTCTATCTACTGTGTCCCA[A/G]GCTTCTTTATTTAAGAAAAAAGTGA
Phenotype: MIM: 605310 MIM: 164177 MIM: 600912
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CCHCR1 PubMed Links

Gene Details

Gene: CCHCR1
Gene Name: coiled-coil alpha-helical rod protein 1

There are no transcripts associated with this gene.

Gene: POU5F1
Gene Name: POU class 5 homeobox 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001173531.2	2039	UTR 3			NP_001167002.1
NM_001285986.1	2039	UTR 3			NP_001272915.1
NM_001285987.1	2039	UTR 3			NP_001272916.1
NM_002701.5	2039	Intron			NP_002692.2
NM_203289.5	2039	UTR 3			NP_976034.4

Gene: PSORS1C3
Gene Name: psoriasis susceptibility 1 candidate 3 (non-protein coding)

There are no transcripts associated with this gene.

Gene: TCF19
Gene Name: transcription factor 19

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077511.1	2039	Intron			NP_001070979.1
NM_001318908.1	2039	Intron			NP_001305837.1
NM_007109.2	2039	Intron			NP_009040.2

View Full Product Details