Product Details

SNP ID: rs1227308
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.15:68285956 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTTTTTTTTTGGTATTCTGTTCCA[A/G]AAATTGTGATCAACACTAAATTCAT
Phenotype: MIM: 613539
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: FEM1B PubMed Links
Additional Information: For this assay, SNP(s) [rs116622280] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015322.4		Intron			NP_056137.1
XM_017021859.1		Intron			XP_016877348.1